Corrigendum: A Survey Using High-Throughput Sequencing Suggests That the Diversity of Cereal and Barley Yellow Dwarf Viruses Is Underestimated

Abstract

In the original article, there was a typographical mistake in ** Table 1** as published. ** The sequence of Yan-R primer should read "TGTTGAGGAGTCTACCTATTTG". The Yan-R primer sequence was given correct in the Supplementary Table 2. The correct Yan-R primer was used in experiments undertaken in this study and thus it does not impact on validity of the results**. The corrected ** Table 1** appears below.The authors apologize for this error and state that this does not change the scientific conclusions of the article in any way. The original article has been updated.

Topics & Concepts