Litcius/Paper detail

<scp><i>GoPGS</i></scp> regulates cotton pigment gland size and contributes to biotic stress tolerance through jasmonic acid pathways

Yue Sun, Yifei Han, Bin Liu, Meng Jiang, Kuang Sheng, Huazu Li, Ping Yang, Qian‐Hao Zhu, Jie Sun, Jinhong Chen, Shuijin Zhu, Tianlun Zhao

2024New Phytologist10 citationsDOIOpen Access PDF

Abstract

The occurrence of crop pests and diseases forms one of the major constraints for achieving better cotton productivity and fiber quality (Wen et al., 2023). Pigment glands, one of the major characteristics of Gossypium genus and its relatives, own unique capacity to synthesize and store various terpenoids such as gossypol, heliocides, and hemigossypolone (Fryxell, 1968; Wen et al., 2023; Lin et al., 2023a). And these terpenoid inclusions of pigment glands contribute to the natural resistance to insects such as Helicoverpa armigera and pathogens such as Verticillium dahliae (Gao et al., 2013; Krempl et al., 2016; Lin et al., 2023b). Up to now, several genes regulating development of pigment glands and accumulation of gland inclusions have been identified, such as GoPGF, CGF1, and CGF2, among which GoPGF is the most critical one for development of pigment glands (Ma et al., 2016; Janga et al., 2019; Zhang et al., 2024). However, the regulatory networks of pigment gland development remain poorly understood, especially those determining the size of pigment glands and its relationship with biotic stress tolerance. Here, we demonstrate Gossypium Pigment Gland Size (GoPGS) to be the key gene regulating the size of pigment glands and cotton plants with bigger pigment glands as a result of repressed GoPGS expression were more resilient to H. armigera and V. dahliae. In single-cell transcriptome atlas of cotton cotyledon, GbiPGS, the homolog of GoPGS (GH_A12G0470/GH_D12G0482) in Gossypium bickii, was first uncovered as a new marker gene of pigment gland cells based on its specific expression pattern (Fig. 1a). Besides, the differential expression of GoPGS homologs in 20–30 DPA (day postanthesis; 20–30 DPA is the critical period for pigment gland formation in glanded cotton) ovules from normal glanded cotton and cotton showing the delayed pigment gland morphogenesis phenotype also suggested a role of GoPGS homologs in development of pigment glands (Fig. 1b). Moreover, the expression of GoPGS was almost undetectable in glandless leaves of upland cotton (Gossypium hirsutum) (Fig. 1c). Together, these results indicated an essential role of GoPGS in pigment gland development. GoPGS encodes a VQ motif-containing protein which is phylogenetically closely related to JAV1/VQ22 of Arabidopsis thaliana, a negative regulator of plant defense (Supporting Information Fig. S1a). GoPGS localizes in both the nucleus and the cell cytosol (Fig. S1b). The expression profiles of GoPGS were consistent with the presence and absence of glands (Fig. S1c). In order to confirm the contribution of GoPGS to pigment gland development, we first phenotyped pigment gland development in cotton plants with GoPGS silenced by virus-induced gene silencing (VIGS) (Figs 1d, S2a). Silencing GoPGS reduced the number of pigment glands in leaves and stems but significantly enlarged the size of pigment glands (Fig. 1e,f). Compared to the controls, the diameter of the pigment gland and its cavity increased twofold, and the pigment gland cell layer and secretory cell width increased 1.5-fold in the GoPGS-silenced plants (Fig. 1g,h). We further knocked out GoPGS by CRISPR–Cas9-mediated genome editing using sgRNAs targeting both At and Dt homeologs (Fig. S3). Similar to the phenotype observed in the GoPGS-silenced plants, the size of leaf pigment glands was significantly larger in the GoPGS knockout mutants than in wild-type (Fig. 1i–k). Together, these results demonstrate that GoPGS negatively regulates pigment gland size. To explore the regulatory relationship between GoPGS and the core regulator of pigment gland development, GoPGF, we analyzed the expression of GoPGS in GoPGF-silenced plants and found it being significantly decreased, suggesting that GoPGS is likely to function downstream of GoPGF (Fig. 2a). The previous ChIP-seq analysis identified a GoPGF binding peak at the promoter of GoPGS (Table S1; Zhang et al., 2024). Yeast one-hybrid assay (Y1H assay) and electrophoretic mobility shift assay (EMSA) confirmed binding of GoPGF to the promoter of GoPGS (Fig. 2b,c). And dual luciferase reporter (DLR) assay showed a twofold increase of LUC/REN ratio when GoPGF and ProGoPGS:LUC were co-expressed compared to the control, indicating the activation effect of GoPGF on GoPGS expression (Fig. 2d). Altogether, these findings unequivocally reveal the ability of GoPGF to directly activate the transcription of GoPGS. To better understand the mechanism of GoPGS in determination of pigment gland size, we compared the transcriptomes of leaves of TRV:00 and TRV:GoPGS, and identified 1308 differentially expressed genes (DEGs). The GO and KEGG pathway analysis revealed enrichment of terms related to jasmonic acid (JA) signaling pathway (Figs 2e, S4). In concordance with the elevated expression of JA synthesis and signaling pathway genes (Fig. S2b), the content of JA was significantly increased in TRV:GoPGS leaves (Fig. 2f). To confirm whether increased JA content causes the enlarged pigment gland phenotype, MeJA (200 μM) was exogenously applied to 14-d-old cotton seedlings. The results showed that exogenous application of MeJA effectively increased the diameter of pigment glands without changes on gland density (Fig. 2g–i). These results demonstrate a positive role of JA in regulation of cotton pigment gland size. In agreement with the enlarged pigment gland size, the content of gland inclusions, including gossypol and related terpenoids, significantly increased in the MeJA treated cotton plants (Fig. 2j) and GoPGS-silenced plants (Fig. 2k), implying that pigment gland size is momentous for accumulation of terpenoids. Given the crucial role of JA and gossypol-related terpenoids in cotton defense against biotic stresses (Kessler et al., 2004; Gao et al., 2013), we challenged the GoPGS-silenced plants with V. dahliae and H. armigera, the most destructive cotton disease and pest, respectively, to know whether the enlarged pigment gland size and the increased content of terpenoids contribute to biotic stress tolerance. Indeed, upon V. dahliae infection, the disease index was significantly lower in the GoPGS-silenced plants than in the control (Fig. 2l). The growth of H. armigera larval was also obviously curtailed when fed with GoPGS-silenced leaves (Fig. 2m). In line with these results, enlarged pigment gland size as a result of GoPGS silencing enhanced expression of the genes related to biosynthesis of gossypol and JA (Fig. S2b,c), leading to increased content of terpenoids, elevated JA content, and enhanced expression of the genes associated with defense response (Figs 2f, S2d). These results suggest that the native tolerance of cotton plants to the major biotic stressors can be improved by downregulating GoPGS. In conclusion, we identified GoPGS to be a novel regulator of pigment gland development. GoPGS seems to be activated by binding of GoPGF to its promoter and functions downstream of GoPGF. Silencing GoPGS increases the size of pigment glands, leading to enhanced biosynthesis and accumulation of gossypol-related terpenoids, which seems to be achieved via the JA biosynthesis and signaling pathways. Importantly, elevated JA content and increased accumulation of gossypol-related terpenoids as a result of GoPGS silencing positively contributes to cotton tolerance to the major biotic stressors, V. dahliae and H. armigera (Fig. 2n). We anticipate that the gene editing approach can be adopted to manipulate the activity of GoPGS to develop novel cotton germplasm with improved resistance to biotic stresses. Upland cotton (Gossypium hirsutum L.) cultivar TM-1 was maintained in a glasshouse under a 16 h : 8 h, light : dark photoperiod at 25°C. Nicotiana benthamiana plants were maintained in a glasshouse at 22°C under a 16 h : 8 h, light : dark cycle. The VIGS assays were conducted following the previously published protocol (Li et al., 2019). DNA fragments with high similarity in the At and Dt homeologs of GoPGS were amplified through PCR using gene-specific primers as listed in Table S2. Two weeks after infiltration, the second true leaf was collected for subsequent assays. All VIGS experiments were performed three times. Fifteen replicates were obtained for each sample to measure the pigment gland diameter and density. The protocols for sample treatment and determination of gossypol and related sesquiterpenes content were described in a previous study (Tian et al., 2018; Huang et al., 2020). For CRISPR–Cas9-mediated gene knockout, the genomic DNA sequence of GoPGS was analyzed by an online toolkit (http://crispr.hzau.edu.cn/cgi-bin/CRISPR2/). To improve the editing efficiency, two putative target sites (GCTGGCGTCAGCATTGAGAAGGG and GCCTTAGTGCAACGATTTACTGG) were selected and assembled into the pYLCRISPR–Cas9 vector. Gossypium hirsutum cv TM-1 was stably transformed with the vector. Total RNA was extracted from cotton second true leaves and quantitative polymerase chain reaction analysis was performed as previously described (Sun et al., 2023). Three independent biological replicates were used for each analysis with at least three technical replicates each. GhUBQ was used as the internal control, which was stably expressed in cotton plants and not affected by treatments and genotypes. All primers are listed in Table S2. Bulk RNA samples were extracted from the second true leaves of TRV:00 and TRV:GoPGS. Three biological replicates were obtained for each sample. G. hirsutum genome (https://www.cottongen.org/species/Gossypium_hirsutum/ZJU-AD1_v2.1) was used for alignment. The analysis of bulk RNA-Seq data were conducted following the previously published protocol (Sun et al., 2023). P value < 0.05 and |log2(foldchange)| > 1 were set as the thresholds for identification of significantly differentially expressed genes. The coding sequence of GoPGF was cloned into the pGEX6P-1 vector and subsequently expressed in E. coli strain BL21 (DE3). The expression of the recombinant protein GoPGF-His was induced with 0.1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) overnight at 16°C, and purified using GST MAG Agarose Beads. The electrophoretic mobility shift assays (EMSAs) were conducted using a chemiluminescent EMSA Kit, according to the manufacturer's instructions. The biotin-labelled DNA probes were synthesized by the Gene Create (Wuhan, China). The probe sequence is tgacccatttgataattgatattaacacacgttgtttccaggaagctgctctgctttgg. Three consecutive copies of the binding motifs in GoPGS promoter were cloned into pHIS vectors. The complete coding sequence of GoPGF was recombined into pGADT7-Rec2 plasmids. The empty pGADT7-Rec2 vector and pHIS vectors were served as negative controls. These recombination plasmids were assembled and subsequently introduced into the yeast strain Y187. Clones were cultured on selective medium SD/-Trp/-Leu at 30°C. After 2 d, the clones were transferred to selection medium (SD/-Trp/-Leu/-His medium) and grown for 3 d. The upstream 2000-bp promoter of GoPGS was amplified from genomic DNA extracted from G. hirsutum TM-1 and cloned into the pGreenII 0800-LUC vector to be used as reporter plasmids. The open-reading frame (ORF) of GoPGF was cloned into the pHB vector as effector. Subsequently, dual luciferase transcriptional activity assays were performed in N. benthamiana leaves as previously described (Gao et al., 2021). Normalized data were presented as the ratio of luminescent signal intensity for reporter vs internal control reporter (35Spro:REN) from three independent biological samples. The full-length open-reading frame (ORF) of GoPGS was amplified using specific primers and cloned upstream of the 5′-end of the GFP gene (GFP) in the pCAMBIA1300 vector containing the mannopine synthase promoter (maspro). Subcellular localization assays were performed in N. benthamiana plants as previously described (Gao et al., 2021). To study the effect of MeJA on pigment gland development in cotton seedlings, 2-wk-old cotton seedlings were treated with 200 μM MeJA and CK (0 μM) by spraying the aerial parts with 2 ml per seedling once a day for 5 d. The experiments were performed three times, with at least 32 seedlings per treatment each time. The third true leaves were obtained for pigment gland statistics and metabolite content assays. Cotton seedlings at the two true-leaf stage were inoculated with V. dahliae V991 spore suspensions through injured roots. The V. dahliae-treated seedlings were cultured in a growth chamber at 25°C under a 16 h : 8 h, light : dark cycle. The experiments were performed with at least 32 seedlings per treatment and 9 independent treatments were performed. The proportion of diseased plants and the disease index were calculated as previously described (Li et al., 2019). The degree of wilt plants was evaluated and divided into five grades from 0 to 4 based on their disease severity, and the disease index was calculated with the following formula: disease index = ((∑disease grade × the number of infected plants)/(total assessed plants × 4)) × 100. Third-instar H. armigera larvae (Keyun Biology) were fostered in the laboratory at 25°C under a 16 h : 8 h, light : dark cycle. These larvae were divided into groups containing 21 individuals each and fed freshly collected second true leaves collected from TRV:00 or TRV:GoPGS seedlings. As previously described (Lin et al., 2023b), each larva was raised individually, and transferred to separate containers supplied with fresh leaves once a day. After they had fed on the indicated diets for 3 d, their weight gain was recorded. We thank Deli Sun (Agricultural Experiment Station, Zhejiang University) for his kind help in planting the materials. We thank Bio-ultrastructure analysis Lab of Analysis center of Agrobiology and environmental sciences, Zhejiang University for the guidance of scanning electron microscope. This work was supported by the National Science Foundation of China (32101764), the National Key R&D Program of China (2022YFF1001403), Jiangsu Collaborative Innovation Center for Modern Crop Production and China Postdoctoral Science Foundation (2023M743079). None declared. SZ and TZ conceived and designed the project. YS, YH and BL performed the experiments. MJ, KS, HL PY JS and JC contributed to project discussion. YS and TZ analyzed the data and wrote the manuscript draft, and SZ and Q-HZ revised it. All authors read and approved the final manuscript. All the data and materials integral to this study are available within the article and the Supporting Information. Fig. S1 The information of GoPGS. Fig. S2 Relative expression levels of genes in the TRV:GoPGS leaves, compared to the TRV:00. Fig. S3 The information about the GoPGS knockout mutant (GoPGS-KO) introduced by CRISPR–Cas9. Fig. S4 The KEGG enrichment analysis of the DEGs between the leaves of TRV:00 and TRV:GoPGS. Table S1 The information of GoPGF targets with CHIP-seq peaks located in their promoter region (Zhang et al., 2024). Table S2 Primers used in this study. Please note: Wiley is not responsible for the content or functionality of any Supporting Information supplied by the authors. Any queries (other than missing material) should be directed to the New Phytologist Central Office. Please note: The publisher is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.

Topics & Concepts

Jasmonic acidBiotic stressPigmentBiologyBotanyCell biologyChemistryBiochemistryAbiotic stressSalicylic acidOrganic chemistryGeneMosquito-borne diseases and controlInsect and Pesticide ResearchInsect Resistance and Genetics