Novel insights into the TRPV3-mediated itch in atopic dermatitis

Abstract

Chronic pruritus (itch) is a widespread and debilitating condition associated with dermatologic, systemic, neuropathic, or psychogenic disorders. The pathophysiologic mechanisms underpinning the transduction and potentiation of this refractory pruritus remain unclear. Current therapeutics are largely ineffective.1Weidinger S. Beck L.A. Bieber T. Kabashima K. Irvine A.D. Atopic dermatitis.Nat Rev Dis Primers. 2018; 4: 1Crossref PubMed Scopus (125) Google Scholar Thus, we have aimed to address this gap in knowledge by specifically focusing on clinically relevant intercellular communication in human skin cells, murine models of acute and chronic itch, and samples from human atopic dermatitis (AD) and psoriasis. In conditions of chronic dermatologic itch such as AD and psoriasis, certain members of the transient receptor potential (TRP) ion channel superfamily play an important role in the propagation of itch signaling. TRP vanilloid channel 3 (TRPV3) is a calcium-permeable cation channel that is abundantly expressed in epidermal keratinocytes. TRPV3 detects warm temperatures (>33°C), is gated by a wide range of chemical stimuli, and plays an essential role in skin homeostasis and repair. Heat-induced activation of TRPV3 stimulates the release of a potent itch inducer, thymic stromal lymphopoietin (TSLP), from cultured murine keratinocytes.2Yamamoto-Kasai E. Yasui K. Shichijo M. Sakata T. Yoshioka T. Impact of TRPV3 on the development of allergic dermatitis as a dendritic cell modulator.Exp Dermatol. 2013; 22: 820-824Crossref PubMed Scopus (26) Google Scholar In mice, intradermal injection of carvacrol, a TRPV3 agonist, elicits scratching behaviors. Gain-of-function mutations in TRPV3 have been confirmed in Olmsted syndrome, a rare pruritic genodermatosis in humans3Lin Z. Chen Q. Lee M. Cao X. Zhang J. Ma D. et al.Exome sequencing reveals mutations in TRPV3 as a cause of Olmsted syndrome.Am J Hum Genet. 2012; 90: 558-564Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar and associated with AD-like inflammation in rodents. TRPV3 is upregulated in the skin of patients with AD.2Yamamoto-Kasai E. Yasui K. Shichijo M. Sakata T. Yoshioka T. Impact of TRPV3 on the development of allergic dermatitis as a dendritic cell modulator.Exp Dermatol. 2013; 22: 820-824Crossref PubMed Scopus (26) Google Scholar Despite this, much remains unknown about the clinical relevance of TRPV3-linked pathways in human dermatitis and pruritus. Herein, real-time PCR was used to quantify TRPV3 expression in the skin of AD-like protease-activated receptor 2 (PAR2)-overexpressing mouse (Grhl3PAR2/+ mice). The level of TRPV3 transcripts was significantly increased in lesional skin of Grhl3PAR2/+ mice versus in age-matched wild-type controls (Fig 1, A). Moreover, relative TRPV3 levels were significantly higher in lesional skin of Grhl3PAR2/+ mice than in nonlesional Grhl3PAR2/+ mice (Fig 1, A), suggesting that TRPV3 expression is associated with the severity of dermatitis. Human skin samples were then examined to evaluate the clinical relevance of these murine findings. Specimens were collected from patients with AD (both lesional AD [LAD] and nonlesional AD [NLAD]), from patients with psoriasis (both lesional psoriasis [LPS] and nonlesional psoriasis [NLPS]), and from healthy controls (HC). All were analyzed by RNA sequencing, with data indicating the mean change in transcript level relative to HC. In LAD samples, TRPV3 was the only member of the TRPV family to be upregulated, with transcripts showing greater than a 2-fold increase over the HC levels (Fig 1, B). Similar to our murine model, this upregulation was absent in NLAD skin (Fig 1, C). Levels of TRPV3 transcripts were also increased in LPS skin samples versus in HC skin samples, but not in NLPS samples versus in HC samples (Fig 1, D). No significant difference was detected in the TRPV3 transcription level in LAD samples versus in LPS samples (Fig 1, E). Furthermore, immunohistochemical evaluation of the LAD samples showed high levels of TRPV3 protein, revealing a striking increase when compared with the levels in the HC samples (Fig 1, F). Importantly, this upregulation was primarily localized to the keratinocyte layer. Similarly, a recent report described an enhanced TRPV3 immunosignal in LPS skin.4Seo S.H. Kim S. Kim S.E. Chung S. Lee S.E. Enhanced thermal sensitivity of TRPV3 in keratinocytes underlies heat-induced pruritogen release and pruritus in atopic dermatitis.J Invest Dermatol. 2020; 140: 2199-2209.e6Abstract Full Text Full Text PDF PubMed Scopus (5) Google Scholar Together, these findings provide a clear link between TRPV3 expression and lesional AD and lesional psoriasis. Previous reports from our group demonstrated the importance of the neuropeptide B-type natriuretic peptide (BNP) in IL-31–induced AD skin inflammation,5Meng J. Moriyama M. Feld M. Buddenkotte J. Buhl T. Szollosi A. et al.New mechanism underlying IL-31-induced atopic dermatitis.J Allergy Clin Immunol. 2018; 141: 1677-1689Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar,6Meng J. Wang J. Buddenkotte J. Buhl T. Steinhoff M. Role of SNAREs in the atopic dermatitis-related cytokine secretion and skin-nerve communication.J Invest Dermatol. 2019; 139: 2324-2333Abstract Full Text Full Text PDF PubMed Scopus (2) Google Scholar building on earlier evidence of its role in itch transmission.7Mishra S.K. Hoon M.A. The cells and circuitry for itch responses in mice.Science. 2013; 340: 968-971Crossref PubMed Scopus (276) Google Scholar As both NPR1 and NPR2 are expressed on human keratinocytes,5Meng J. Moriyama M. Feld M. Buddenkotte J. Buhl T. Szollosi A. et al.New mechanism underlying IL-31-induced atopic dermatitis.J Allergy Clin Immunol. 2018; 141: 1677-1689Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar,6Meng J. Wang J. Buddenkotte J. Buhl T. Steinhoff M. Role of SNAREs in the atopic dermatitis-related cytokine secretion and skin-nerve communication.J Invest Dermatol. 2019; 139: 2324-2333Abstract Full Text Full Text PDF PubMed Scopus (2) Google Scholar we postulated that BNP may modify TRPV3 expression or activity. First, cultured primary human keratinocytes (phKCs) were stimulated with BNP, substance P (SP), or calcitonin gene–related peptide (all at 1 μM). TRPV3 transcripts were measured by real-time PCR. Only BNP resulted in a significant increase in TRPV3 mRNA levels (Fig 1, G), suggesting that this AD-linked neuropeptide may be responsible for the upregulation of TRPV3 that is evident in our murine and human dermatitis samples. Calcium imaging was then used to investigate whether BNP could affect the functional activity of the TRPV3 cation channel. Here, phKCs were stimulated with 1 of 2 concentrations of drofenine (250 μM or 500 μM), a specific and potent activator of TRPV3, after which the resulting calcium dynamics were recorded. In addition, a subset of phKCs were preincubated with BNP (1 μM for 4 hours) before stimulation with the lower concentration of drofenine (250 μM) (Fig 1, H). The BNP incubation time (4 hours) was chosen on the basis of a previous study showing that in keratinocytes the TRPV3 sensitivity was altered by TGFα treatment at 3 to 5 hours.8Cheng X. Jin J. Hu L. Shen D. Dong X.P. Samie M.A. et al.TRP channel regulates EGFR signaling in hair morphogenesis and skin barrier formation.Cell. 2010; 141: 331-343Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar Both concentrations of drofenine resulted in notable calcium fluctuations (Fig 1, I; representative traces). BNP pretreatment significantly enhanced the drofenine-induced (250 μM) calcium flux, as indicated by the area under the curve (Fig 1, J). When expressed as peak calcium fluctuation versus the time at which this peak was reached (Timemax), drofenine-responsive phKCs were found to cluster into 2 distinct subpopulations (Fig 1, K and L) (rapid and slow, with rapid responders found in the gray shaded area in Fig 1, L). Importantly, preincubation with BNP resulted in a striking increase in the percentage of rapid responders following drofenine (250 μM) application (Fig 1, K and L). It is postulated that this subset of phKCs express high levels of TRPV3. A separate experiment found that stimulation with BNP alone resulted in calcium fluctuations in just a small population (0.8%) of phKCs, with responders displaying low-amplitude transients (Fig 1, M). Together, these data demonstrate that BNP can increase TRPV3-associated calcium responses, perhaps through sensitization or upregulation of the TRPV3 channel on the cell surface. Although keratinocyte-derived mediators are known to facilitate dermatitis, little is known about TRPV3-induced intercellular communication. To address this, phKC-expressed TRPV3 was activated with drofenine (500 μM) and the supernatant was analyzed by cytokine array. Levels of both serpin E1 and TGFα were found to be significantly increased (∼1.8-fold and ∼2 -fold, respectively [Fig 2, A]). To confirm that drofenine-induced pharmacologic effects are mediated by TRPV3, we performed an experiment examining knockdown of TRPV3 by using short-hairpin RNA lentivirus. The latter reduced TRPV3 expression by approximately 75% in phKCs compared with the nontargeted control virus–treated cells (see Fig E1 in this article’s Online Repository at www.jacionline.org). Knockdown of TRPV3 reduced levels of drofenine-elicited serpin E1 release (Fig 2, B) and the calcium transients, as well as the number of cells responding to drofenine (Fig 2, C), indicating that the drofenine-induced responses in phKCs were mediated by TRPV3. In addition, serpin E1 release was found to be facilitated by a specific v-SNARE protein, namely, vesicle associated membrane protein isoform 3 (VAMP3). Following targeted short-hairpin RNA–mediated knockdown of VAMP3 in phKCs (∼90%) (see Fig E2, A in this article’s Online Repository at www.jacionline.org), drofenine-induced serpin E1 release was reduced by approximately 62% (see Fig E2, B in this article’s Online Repository). In contrast, TGFα release was not significantly altered (see Fig E2, B in this article’s Online Repository), suggesting that serpin E1, but not TGFα, is released via exocytotic vesicles. These data reveal a previously unknown intercellular pathway, mediated in part by VAMP3-dependent exocytosis. To investigate whether these TRPV3-linked mediators are involved in human dermatitis, we analyzed serpin E1 and TGF-α transcripts in AD and psoriasis skin by RNA sequencing. Interestingly, serpin E1 was found to be significantly upregulated in patients with LAD versus in HC, showing a striking 5.3-fold increase, whereas, TGF-α levels were not significantly different from those in HC (Fig 2, D). Conversely, the level of TGF-α, but not serpin E1, was significantly increased in patients with LPS compared with in either HCs or patients with NLPS (Fig 2, E). Notably, a 4-fold higher expression of serpin E1 was observed in patients with LAD versus in those with LPS (Fig 2, F). Immunohistochemical evaluation of HC and LAD skin revealed high levels of serpin E1 (red) protein in the samples of LAD skin, but not the HC skin samples (Fig 2, G [left]). The mean fluorescence intensity of serpin E1 in skin samples from patients with LAD was greater than that in samples from HCs, as revealed by analysis of regions of interest encompassing the epidermis of the skin (Fig 2, G [right]). Importantly, serpin E1 expression was primarily localized to the keratinocyte layer. Thus, TRPV3-linked mediators serpin E1 and TGF-α are differentially involved in human AD and psoriasis, representing important disease-specific pathways. Together, these results strengthen the notion that TRPV3 and its downstream mediators are involved in human dermatitis. Serpin E1 is primarily classified as an inhibitor of fibrinolysis. The findings presented herein describe a correlation between serpin E1 expression and dermatitis. However, whether serpin E1 could act as a pruritogen (itch inducer) remained unknown. First, the effect of serpin E1 on mouse dorsal root ganglionic neurons was analyzed by using calcium imaging. In total, approximately 5.3% of mouse dorsal root ganglionic neurons were activated by serpin E1, showing that serpin E1 can directly activate a subpopulation of sensory neurons (Fig 2, H). In a mouse cheek model of itch, intradermal injection of serpin E1 elicited significant site-directed scratching behavior (Fig 2, I), with average scratching bouts peaking at 15 minutes (Fig 2, J). Urokinase plasminogen activator receptor (U-PAR), which is known to bind serpin E1,9Siconolfi L.B. Seeds N.W. Induction of the plasminogen activator system accompanies peripheral nerve regeneration after sciatic nerve crush.J Neurosci. 2001; 21: 4336-4347Crossref PubMed Google Scholar is present in cultured mouse trigeminal ganglionic neurons (see Fig E3 in this article’s Online Repository at www.jacionline.org). In contrast, serpin E1 did not induce wiping (Fig 2, K), a behavior that reflects pain-associated responses, suggesting that serpin E1 may represent a novel and specific itch inducer. Of note, a selective orally active inhibitor of serpin E1 (TM5275) attenuated serpin E1–elicited cheek scratching (Fig 2, L). Moreover, in a prolonged AD-like MC903-associated chronic pruritus mouse model, in which 7 days or longer is required for pruritus to be established, TM5275 also inhibited MC903-evoked itch behaviors at day 9 (Fig 2, M). Thus, serpin E1 represents a novel pruritogen in mice and may promote dermatitis-associated pruritus in humans. Overall, this study provides a clear link between TRPV3 and dermatitis (Fig 2, N). In AD conditions, IL-31 induces BNP synthesis and release from sensory neurons.5Meng J. Moriyama M. Feld M. Buddenkotte J. Buhl T. Szollosi A. et al.New mechanism underlying IL-31-induced atopic dermatitis.J Allergy Clin Immunol. 2018; 141: 1677-1689Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar BNP subsequently binds to NPR1 on keratinocytes to upregulate TRPV3 transcripts. This could increase the surface expression of TRPV3, resulting in heightened TRPV3 activity and increased serpin E1 release. Serpin E1 activates sensory fibers in the skin and promotes itch transduction. Our work has revealed a disease-relevant neuroepidermal pathway for TRPV3 upregulation and sensitization. It also highlights the role of TRPV3-linked mediators in human dermatitis and pruritus, with serpin E1 representing a novel itch inducer (Fig 2, N). On the basis of these results, we believe that targeting TRPV3 signaling will prove beneficial for the treatment of chronic itch conditions. Skin punch biopsy samples were taken from LAD and NLAD skin and LPS and NLPS skin of patients with AD and from HCs after written informed consent had been obtained according to the Declaration of Helsinki principles. The study was institutionally approved by the Medical Research Council, National Scientific and Ethical Committee, Budapest, Hungary (ETT TUKEB, document identifiers: 50935/2012/EKU and 54256-1/2016/EKU). For RNA sequencing (RNA-seq), human samples of AD or psoriasis skin and HC skin samples were obtained from individuals over the age of 17 years. The LAD skin samples were obtained from 5 patients (1 female and 4 males), all with a SCORing Atopic Dermatitis score higher than 35. The LPS skin samples were obtained from 5 patients (3 females and 2 males) with a Psoriasis Area Severity Index severity higher than 11. Note that 2 NLPS samples were from the patients who also donated 2 LPS skin samples. One NLAD sample was derived from a patient who also donated 1 LAD sample. In the case of the paraffin sections of human skin, skin biopsy samples from patients and HCs were obtained under local anesthesia after the patients gave their written consent. Permission for the human studies was given by the Ethical Committee of the University of Göttingen, Germany, in accordance with the ethical standards of the principles of the 1964 Declaration of Helsinki. All animal procedures were performed in accordance with the Guidelines for Care and Use of Laboratory Animals of Henan University and approved by the Animal Ethics Committee of Henan University. cDNA from Grhl3PAR2/+ mouse skin samples (lesional and nonlesional skin samples) were obtained previouslyE1Meng J. Moriyama M. Feld M. Buddenkotte J. Buhl T. Szollosi A. et al.New mechanism underlying IL-31-induced atopic dermatitis.J Allergy Clin Immunol. 2018; 141: 1677-1689Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar and were used for real-time fluorescence detection with the SYBR Green ROX mix (Applied Biosystems Inc). The TRPV3 primers used were as follows: CGCTGGCCTCACTGATTGAGAA (forward) and CCCATGCGGAATCTGCTTCTCA (reverse). RNA-seq was performed by IMGM Laboratories (Martinsried, Germany). In brief, total RNA was isolated by using the RNeasy Fibrous Tissue Mini Kit (Qiagen) from up to 30 mg of human skin tissue from LAD skin (n = 5 patients), NLAD skin (n = 5), LPS skin (n = 5), NLPS skin (n = 2), and HC skin (n = 5) followed by on-column DNase digestion. All samples were analyzed on a 2100 Bioanalyzer (Agilent Technologies) by using RNA 6000 Nano/Pico LabChip kits (Agilent Technologies). Library preparation was performed with 300 ng of total RNA by using the TruSeq Stranded mRNA HT technology. The sequencing library generated by pooling was quantified by using the highly sensitive fluorescent dye–based Qubit ds DNA HS Assay Kit (Invitrogen). Sequencing of the library was performed at a final concentration of 1.8 pM and with a 1% PhiX version 3 control library spike-in (Illumina) on a NextSeq 500 sequencing system (Illumina). Sequencing was performed under control of NextSeq Control Software). Primary image processing was performed on a NextSeq 500 instrument by using Real-Time Analysis version Primary data analysis was performed by using the The Analysis version was used for imaging and evaluation of the sequencing The was used for analysis of The average for upregulated and were A 2-fold change in the was phKCs were into and cultured in with were in the for 2 days before 2 days in cultured phKCs were in short-hairpin RNA that specifically VAMP3 or TRPV3 or nontargeted as described previously in et J. Wang J. Buddenkotte J. Buhl T. Steinhoff M. Role of SNAREs in the atopic dermatitis-related cytokine secretion and skin-nerve communication.J Invest Dermatol. 2019; 139: 2324-2333Abstract Full Text Full Text PDF PubMed Scopus (5) Google Scholar 2 days in the cells were cultured in 1 of for 3 The cells were stimulated by drofenine for release of serpin E1 and TGFα or calcium imaging. the cells were in sample for to confirm the the signaling phKCs were with for at Following cell were and analyzed by using the Human Kit according to the cytokine was analyzed with from the samples were relative to those for control to the In Fig 2, serpin E1 was measured by using an phKCs on the were with 3 μM in for 30 minutes The cells were and to to cells were with an and were at with a a of drofenine (250 μM or 500 μM) or human BNP (1 μM) was fluorescence data were and to time fluorescence by using For calcium were to with the change in fluorescence and the and relative to Only cells showing a increase over were in the drofenine responding cells were in of 3 area under the curve versus intensity of fluorescence and time at which fluorescence was On the basis of the phKCs were into 2 rapid and slow, with rapid responders those with a of 300 or The data represent 3 or with at phKCs [Fig 1, or phKCs [Fig 1, For the serpin calcium transient mouse dorsal root ganglionic neurons were isolated from mice and by as previously J. Moriyama M. Feld M. Buddenkotte J. Buhl T. Szollosi A. et al.New mechanism underlying IL-31-induced atopic dermatitis.J Allergy Clin Immunol. 2018; 141: 1677-1689Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar were cultured in the of and nerve for 7 days in dorsal root ganglionic neurons were with and stimulated with of Serpin E1 were by a 4 using calcium level were to with the fluorescence and the sections of human skin were before in with and then in at for 1 Specimens were then with mouse to TRPV3 or serpin E1 in The were in and with or the final of the were using were taken by using or using mice intradermal of serpin E1 or control into the bouts of to the injection were of pruritus. with the were also analyzed and orally active serpin E1 TM5275 or its was to the mice 1 before the cheek injection of serpin E1 or its control to the of serpin itch To a prolonged model of M. Zhang Z. S. D. and induce thymic stromal lymphopoietin in mouse keratinocytes and an atopic A. PubMed Scopus Google Scholar (4 in was to the of This was for 9 resulting in the of an AD-like chronic itch at day 1, these mice also of TM5275 or its One was to the the mice were for 1 via and itch were are presented as or For were and classified as than from to than from to than or or For the P were by using the or P than were analysis was performed with

Topics & Concepts