Binding of <i>Leishmania spp</i> with gold nanoparticles supported polyethylene glycol and its application for the sensitive detection of infectious photogenes in human plasma samples: A novel biosensor
Ahmad Mobed, Parina Mehri, Mohammad Hasanzadeh, Ahad Mokhtarzadeh
Abstract
Abstract The management of pathogen detection using a rapid and cost‐effective method presents a major challenge to the biological safety of the world. The field of pathogen detection is nascent and therefore, faces a dynamic set of challenges as the field evolves. Visceral leishmaniasis (VL), or kala‐azar is the most severe form of leishmaniasis. Delay to the accurate diagnosis and treatment is likely to lead to fatality. The reliable, fast and sensitive detection is closely linked to safe and effective treatment of Leishmania spp . Despite several routine and old method for sensitive and specificity detection of Leishmania spp , there is highly demand for developing modern and powerfully system. In this study a novel ultra‐sensitive DNA‐based biosensor was prepared for detection of Leishmania spp . For the first time, the specific and thiolated sequences of the Leishmania spp genome (5′‐SH‐[CH 2 ] 6 ATCTCGTAAGCAGATCGCTGTGTCAC‐3′) were recognized by electrochemical methods. Also, selectivity of the proposed bioassay was examined by three sequences that were mismatched in 1, 2, and 3 nucleotides. The linear range (10 −6 to 10 −21 M) and limit of detection (LLOQ = 1 ZM) obtained are remarkable in this study. Also, simple and cost‐effective construction of genosensors was another advantage of the proposal DNA‐based assay. The experimental results promise a fast and simple method in detection of kala‐azar patients with huge potential of the nanocomposite‐based probe for development of ideal biosensors.