Corrigendum to ‘A novel multiplex qPCR assay for detection of Plasmodium falciparum with histidine-rich protein 2 and 3 (pfhrp2 and pfhrp3) deletions in polyclonal infections’
Lynn Grignard, Debbie Nolder, Nuno Sepúlveda, Araia Berhane, Selam Mihreteab, Robert Kaaya, Jody Phelan, Kara A. Moser, Donelly A. van Schalkwyk, Susana Campino, Jonathan B. Parr, Jonathan J. Juliano, Peter L. Chiodini, Jane Cunningham, Colin J. Sutherland, Chris Drakeley, Khalid B. Beshir
Abstract
The authors wish to correct two typographical errors in the manuscript. In the Methods (Section 5.3: Assay optimization), the concentration unit of dNTPs was wrongly written as 800 nM (nanomolar) and should be corrected to 800mM (millimolar). Furthermore, in Table S1 of the Supplementary material, the primers and probe sequences for Pfhrp3 are incorrect. They should be written: Pfhrp3_F2: 5’-ACGGATTTCATTTTAACCCTTCACGA-‘3, Pfhrp3_R2: 5’-TGAGAATCATCAAAACAAGCATTAGC-‘3 and Pfhrp3_probe: JOE’-ACAATTCCCATACTTTACATCATGCA-‘3 BHQ1. A revised Table S1 is included (below). The primers and probe sequences of Pfhrp3 in Figure 3S of the supplementary material are correct. The authors regret any confusion caused and appreciate the opportunity to correct these mistakesTable S1Primers used for the three parasite target genes and one human gene. Pfhrp2_R2 primer was modified at 3' end (T->G, highlighted) to increase specificity. Final primer used in the optimized experiments are highlighted in bold.NamePrimer sequenceReferencePfhrp2_F15’ TAATTSCGYATTTAATAATAACTTGTG-‘3This studyPfhrp2_F25’-TAATTCCGCATTTAATAATAACGTGTG-3’Pfhrp2_F35’-TAATTCCGCATTTAATAATAACGTTGG-3’Pfhrp2_R15’- CATCATCTACATGTGCTTGAG -‘3Pfhrp2_R25’- CATCATCTACATGTGCTGGAG -‘3Pfhrp2_R35’- CATCATCTACATGTGCGTGAG -‘3Pfhrp2_probeFAM 5’-ATGCAAAAGGACTTAATTTAAATAAGAGATT-‘3 BHQ2Pfhrp3_F15’-TCCGAATTTAACAATAACTTGTTTAGC-‘3Pfhrp3-R15’-GTCAAGCACATGCAGGTGATG-‘3Pfhrp3_P1JOE 5’-ATGCAAAAGGACTTAATTCAAATAAGAGATTA-‘3 BHQ1Pfhrp3_F25’-ACGGATTTCATTTTAACCCTTCACGA-‘3Pfhrp3_R25’-TGAGAATCATCAAAACAAGCATTAGC-‘3Pfhrp3_probeJOE’-ACAATTCCCATACTTTACATCATGCA-‘3 BHQ1Pfldh_F5’-ACGATTTGGCTGGAGCAGAT-‘3[1]Parr JB Verity R Doctor SM Janko M Carey-Ewend K Turman BJ et al.Pfhrp2-deleted plasmodium falciparum parasites in the democratic republic of the congo: a national cross-sectional survey.J Infect Dis. 2017; 216: 36-44PubMed Google ScholarPfldh_R5’-TCTCTATTCCATTCTTTGTCACTCTTTC-‘3Pfldh_probeROX 5’-GTAATAGTAACAGCTGGATTTACCAAGGCCCCA-‘3 BHQ1HumTuBB_F5’-AAGGAGGTCGATGAGCAGAT-‘3[2]Beshir KB Hallett RL Eziefula AC Bailey R Watson J Wright SG et al.Measuring the efficacy of anti-malarial drugs in vivo: quantitative PCR measurement of parasite clearance.Malar J. 2010; 9: 312Crossref PubMed Scopus (46) Google ScholarHumTuBB_R5’-GCTGTCTTGACATTGTTGGG-‘3HumanTuBB_PCY5 5’-TTAACGTGCAGAACAAGAACAGCAGCT-‘3 BHQ2 Open table in a new tab The authors would like to apologise for any inconvenience caused. A novel multiplex qPCR assay for detection of Plasmodium falciparum with histidine-rich protein 2 and 3 (pfhrp2 and pfhrp3) deletions in polyclonal infectionsThe new qPCR is easily scalable to routine surveillance studies in countries where P. falciparum parasites lacking pfhrp2 and pfhrp3 are a threat to malaria control. Full-Text PDF Open Access