Janus kinase inhibition in complement component 1 deficiency
Christine Wolf, Normi Brück, Sarah Koss, Constanze Griep, Michael Kirschfink, Katharina Palm-Beden, Mingyan Fang, Nadja Röber, Stefan Winkler, Reinhard Berner, Eike Latz, Claudia Günther, Min Ae Lee‐Kirsch
Abstract
Activation of complement component C1 composed of C1q, C1r, and C1s initiates the classical complement pathway. This occurs by binding of C1q to immune complexes (ICs), apoptotic bodies, or pathogens, leading to autocatalytic activation of C1r and subsequent cleavage of the zymogen C1s. The classical complement pathway is involved in pathogen recognition, antibody-mediated cytotoxicity, and clearance of ICs and apoptotic debris.1Lintner K.E. Wu Y.L. Yang Y. Spencer C.H. Hauptmann G. Hebert L.A. et al.Early components of the complement classical activation pathway in human systemic autoimmune diseases.Front Immunol. 2016; 7: 36Crossref PubMed Scopus (102) Google Scholar Rare monogenic deficiencies in any of the C1 complement components are strongly linked to systemic lupus erythematosus (SLE). Therapy of monogenic C1 deficiency with standard drugs used in SLE remains difficult, and treatment with regular fresh frozen plasma or hematopoietic stem cell transplantation is associated with high risks of complications.1Lintner K.E. Wu Y.L. Yang Y. Spencer C.H. Hauptmann G. Hebert L.A. et al.Early components of the complement classical activation pathway in human systemic autoimmune diseases.Front Immunol. 2016; 7: 36Crossref PubMed Scopus (102) Google Scholar Although constitutive type I IFN activation has recently been reported in C1q and C1r deficiency,2Demirkaya E. Zhou Q. Smith C.K. Ombrello M.J. Deuitch N. Tsai W.L. et al.Brief report: Deficiency of complement 1r subcomponent in early-onset systemic lupus erythematosus: the role of disease-modifying alleles in a monogenic disease.Arthritis Rheumatol (Hoboken, NJ). 2017; 69: 1832-1839Crossref PubMed Scopus (24) Google Scholar,3Bolin K. Eloranta M.-L. Kozyrev S.V. Dahlqvist J. Nilsson B. Knight A. et al.A case of systemic lupus erythematosus with C1q deficiency, increased serum interferon-α levels and high serum interferogenic activity.Rheumatology (Oxford). 2019; 58: 918-919Crossref PubMed Scopus (2) Google Scholar the effect of a type I IFN-targeting therapy has not been demonstrated. Here, we describe 4 children from 2 consanguineous families affected with early-onset SLE due to C1 deficiency. Affected children presented in early childhood with acute and discoid lupus lesions, chilblain lesions, acral ulcerations, oral ulcers, arthritis, patchy alopecia, photosensitivity, antinuclear antibodies, and anti–double-stranded DNA antibodies; 1 patient developed lupus nephritis and 1 patient exhibited neurological signs (see Table E1 and Fig E1 in this article’s Online Repository at www.jacionline.org). All patients were not or only partially responsive to hydroxychloroquine, steroids, methotrexate, mycophenolate mofetil, pentoxifylline, nifedipine, and rituximab. Patients A1 and B1 required regular steroid pulses with methylprednisolone (750 mg/d) and prednisone (300 mg/d), respectively, given over 3 days every 4 weeks to control disease activity. Whole-exome sequencing followed by variant analysis assuming a recessive mode of inheritance led to the identification of homozygous truncating mutations in C1R in family A (c.1754_1778dupACGACCTGGGCTTGATGGGCTATGT, p.Ser594ArgfsTer21) and in C1QC in family B (c.205C>T, p.Arg69Ter), respectively (see Fig E2, A-D, in this article’s Online Repository at www.jacionline.org). The C1R variant has not been annotated in the ExAC or GnomAD databases and represents the third case of C1r deficiency reported to date; the C1QC variant has been reported in 3 patients with C1q deficiency.2Demirkaya E. Zhou Q. Smith C.K. Ombrello M.J. Deuitch N. Tsai W.L. et al.Brief report: Deficiency of complement 1r subcomponent in early-onset systemic lupus erythematosus: the role of disease-modifying alleles in a monogenic disease.Arthritis Rheumatol (Hoboken, NJ). 2017; 69: 1832-1839Crossref PubMed Scopus (24) Google Scholar,3Bolin K. Eloranta M.-L. Kozyrev S.V. Dahlqvist J. Nilsson B. Knight A. et al.A case of systemic lupus erythematosus with C1q deficiency, increased serum interferon-α levels and high serum interferogenic activity.Rheumatology (Oxford). 2019; 58: 918-919Crossref PubMed Scopus (2) Google Scholar Sanger sequencing of all family members confirmed full segregation of the identified mutations. Complement analysis revealed complete absence of classical pathway activation due to lack of C1 activity in all patients, which could be fully restored by substitution of recombinant C1 (Fig E2, E and F). Unlike wild-type controls, fibroblasts from patient A1 failed to produce or to autoproteolytically activate full-length C1r and to process C1s (Fig E2, G), whereas C1qC protein was undetectable in fibroblasts from patient B1 (Fig E2, H), confirming complete C1 deficiency in both patients. Quantitative RT-PCR revealed a markedly increased expression of IFN-stimulated genes in blood as shown by elevated IFN scores in all patients, consistent with constitutive type I IFN activation (Fig 1, A). Deposition of nucleic acid–containing ICs causing innate immune activation and local tissue damage is a hallmark of SLE pathogenesis. Given defective clearance of ICs in C1 deficiency, we assessed the effect of purified ICs on IFN-β production. Stimulation of healthy donor PBMCs with ICs isolated from patients A1 and B1 led to a strong IFN-β secretion compared with ICs isolated from control individuals (Fig 1, B), indicating that patient ICs are sufficient to confer type I IFN activation. Activation of nucleic acid–sensing Toll-like receptors (TLRs) by ICs has been demonstrated to induce type I IFN in SLE.4Means T.K. Latz E. Hayashi F. Murali M.R. Golenbock D.T. Luster A.D. Human lupus autoantibody-DNA complexes activate DCs through cooperation of CD32 and TLR9.J Clin Invest. 2005; 115: 407-417Crossref PubMed Google Scholar To further determine whether innate immune activation is TLR-dependent in the patients, we transfected human embryonic kidney (HEK) cells constitutively expressing RNA-sensing TLR7 (HEK-CD32-TLR7) or DNA-sensing TLR9 (HEK-CD32-TLR9), respectively, with the FcγRII receptor (CD32), which is required for IC internalization.4Means T.K. Latz E. Hayashi F. Murali M.R. Golenbock D.T. Luster A.D. Human lupus autoantibody-DNA complexes activate DCs through cooperation of CD32 and TLR9.J Clin Invest. 2005; 115: 407-417Crossref PubMed Google Scholar Stimulation of HEK-CD32-TLR7 and HEK-CD32-TLR9 with ICs purified from patients A1 and B1, but not from 2 healthy controls, strongly induced IFN-β secretion to a similar extent, which was accompanied by significantly increased secretion of proinflammatory IL-8 (Fig 1, C-F). Thus, FcγRII receptor-mediated uptake of nucleic acid–containing ICs can activate endosomal TLR7 and TLR9, consistent with autoantibodies against ribonucleoproteins and double-stranded DNA observed in both patients. Binding of type I IFN to the IFN-α/β receptor initiates the Janus kinase/signal transducers and activators of transcription (JAK/STAT) pathway through activation of receptor-associated JAK1 and tyrosine kinase 2. This induces phosphorylation of the transcription factors STAT1 and STAT2, which dimerize and translocate to the nucleus to activate transcription of IFN-α/β and numerous IFN-stimulated genes. JAK1/2 inhibitors such as baricitinib blunt chronic type I IFN activation by impeding IFN-α/β receptor signaling and were recently shown to be therapeutically effective in patients with monogenic type I interferonopathies.5König N. Fiehn C. Wolf C. Schuster M. Cura Costa E. Tüngler V. et al.Familial chilblain lupus due to a gain-of-function mutation in STING.Ann Rheum Dis. 2017; 76: 468-472Crossref PubMed Scopus (161) Google Scholar, 6Sanchez G.A.M. Reinhardt A. Ramsey S. Wittkowski H. Hashkes P.J. Berkun Y. et al.JAK1/2 inhibition with baricitinib in the treatment of autoinflammatory interferonopathies.J Clin Invest. 2018; 128: 3041-3052Crossref PubMed Scopus (258) Google Scholar, 7Zimmermann N. Wolf C. Schwenke R. Lüth A. Schmidt F. Engel K. et al.Assessment of clinical response to Janus kinase inhibition in patients with familial chilblain lupus and TREX1 mutation.JAMA Dermatol. 2019; 155: 342-346Crossref PubMed Scopus (43) Google Scholar We therefore investigated the effect of baricitinib on type I IFN activation in patient cells in vitro. Stimulation of whole blood from a healthy control with the RNA-analogue poly(I:C) led to a robust type I IFN activation, which could be efficiently suppressed by baricitinib (Fig 1, G). In contrast, whole blood of patients A1 and B1 exhibited a strong IFN signature at baseline that could only barely be further stimulated by poly(I:C), whereas administration of baricitinib led to a sustained reduction in type I IFN activation (Fig 1, H). We next assessed the therapeutic effect of JAK1/2 inhibition with baricitinib in patients A1 and B1. Because pediatric patients were recently shown to require higher doses than adults because of increased drug metabolism,8Kim H. Brooks K.M. Tang C.C. Wakim P. Blake M. Brooks S.R. et al.Pharmacokinetics, pharmacodynamics, and proposed dosing of the oral JAK1 and JAK2 inhibitor baricitinib in pediatric and young adult CANDLE and SAVI patients.Clin Pharmacol Ther. 2018; 104: 364-373Crossref PubMed Scopus (54) Google Scholar patient A1, who was 8 years when therapy was initiated, was given 6 mg baricitinib daily, while patient B1, who was 17 years when therapy was started, received 4 mg. In both patients, baricitinib led to a marked suppression of systemic type I IFN activation as shown by a reduction in IFN scores that remained sustained over the course of treatment of 25 and 24 months, respectively (Fig 2, A and B). Patients improved clinically with healing of skin lesions and amelioration of joint involvement and alopecia (Fig 2, C and D). In both patients, steroid pulses were no longer required. Patient A1 continued to receive hydroxychloroquine (200 mg/d) and prednisolone (5 mg/d), whereas patient B1 received hydroxychloroquine (200 mg/d) and a reduced dose of mycophenolate mofetil of 500 mg/d. Clinical improvement was also reflected by reduced activity scores of the Cutaneous Lupus Erythematosus Disease Area and Severity Index (Fig 2, E and F). Flares only mildly and rarely occurred during infection. In patient A1, anti-Ro60 strongly declined during baricitinib treatment, whereas lymphocyte counts increased. Antinuclear antibodies decreased only slightly. In patient B1, lymphocyte counts remained within normal limits, whereas antinuclear antibodies and anti-Ro60 declined during treatment (Fig 2, E and F). Treatment was well tolerated without any adverse effects. In summary, we delineate deficiencies in C1r and C1q as bona fide type I IFN interferonopathies and demonstrate the therapeutic efficacy of baricitinib. Further clinical studies are required to assess the long-term benefits and side effects of baricitinib in patients with type I IFN-dependent autoimmune disorders. Notably, we observed a significant improvement in cutaneous symptoms that was not sufficiently assessed in a recent phase II clinical trial of baricitinib in complex SLE,9Wallace D.J. Furie R.A. Tanaka Y. Kalunian K.C. Mosca M. Petri M.A. et al.Baricitinib for systemic lupus erythematosus: a double-blind, randomised, placebo-controlled, phase 2 trial.Lancet. 2018; 392: 222-231Abstract Full Text Full Text PDF PubMed Scopus (253) Google Scholar underpinning the necessity of patient stratification. Notwithstanding, given the central role of complement and type I IFN in SLE pathogenesis, our findings suggest that JAK inhibition may represent a valuable therapeutic approach for certain forms of multifactorial SLE as well. We thank the patients and their families for participation in the study. We thank Johan Rönnelid, Uppsala University, for helpful discussion, and Kerstin Engel, Susan Hunger, and Vanessa Gilly for excellent technical assistance. Genomic DNA was extracted from blood using Qiamp DNA Blood Mini Kit (Qiagen, Hilden, Germany). Constructed exome libraries were subjected to Illumina Hiseq4000/Xten (Illumina, Berlin, Germany) 150 bp paired-end sequencing with an average read depth of 134.5X. SOAPnuke was used to remove adapter sequences, low-quality reads, and N reads.E1Chen Y. Chen Y. Shi C. Huang Z. Zhang Y. Li S. et al.SOAPnuke: a MapReduce acceleration-supported software for integrated quality control and preprocessing of high-throughput sequencing data.Gigascience. 2018; 7: 1-6Crossref Scopus (317) Google Scholar Sequences were mapped to the human reference genome (GRCh37/UCSC hg19) by Burrows-Wheeler Algorithm (BWA-MEM, version 0.7.10).E2Li H. Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform.Bioinformatics. 2009; 25: 1754-1760Crossref PubMed Scopus (24592) Google Scholar GATK Haplotype Caller (version 3.3)E3McKenna A. Hanna M. Banks E. Sivachenko A. Cibulskis K. Kernytsky A. et al.The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data.Genome Res. 2010; 20: 1297-1303Crossref PubMed Scopus (13658) Google Scholar was used for single nucleotide variants and insertions/deletions (InDels) calling and Ensembl Variant Effect PredictorE4McLaren W. Gil L. Hunt S.E. Riat H.S. Ritchie G.R.S. Thormann A. et al.The Ensembl Variant Effect Predictor.Genome Biol. 2016; 17: 122Crossref PubMed Scopus (2479) Google Scholar for annotation. The mutations of the C1R (NM_001733) and C1QC (NM_001114101) genes were amplified by PCR using gene- specific primers (Eurofins MWG Operon; C1R: for-CCACACCCTGTATCCCAAGG, rev-TCTCTTTCTTGATCCAGTCCACG; C1QC: for-TCTGCCTTCTCCATCTCCAG, rev-CCGTGAACACTGACTGGAATTT) and sequenced in both directions using the BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Waltham, Mass) on a 3130xl Genetic Analyzer (Applied Biosystems). Data were analyzed using the Vector NTI Software (Life Technologies, Darmstadt, Germany). Blood was collected in serum tubes (Sarstedt), centrifuged at 3000 rpm for 15 minutes, and frozen until assayed. Complement activity was measured using standard hemolytic assays (CH50, C1 titration, resubstitution assays) at the Diagnostic Laboratory of the Institute of Immunology (University of Heidelberg, Heidelberg, Germany). Passage-matched fibroblasts (passages 4-15) were cultured in Dulbecco modified Eagle medium complete medium (Dulbecco modified Eagle medium high glucose 4.5 g/L supplemented with 2 mM l-glutamine, 1% antibiotics/antimycotics, 5% NEAA, 10% FCS). Fibroblast cells were lysed in RIPA buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1 mM sodium orthovanadate, 20 mM sodium fluoride) supplemented with 1× Complete Protease Inhibitor Cocktail, 1× PhosSTOP phosphatase inhibitors (Roche, Basel, Switzerland), and Dnase I (Qiagen). Protein concentration was determined using a BCA Kit (Thermo Scientific). Supernatants were collected and concentrated using Amicon Ultra Centrifugal filters with a cutoff of 10 K. For measurement of secreted C1r, cells were seeded at a density of 2 × 105 cells/25 cm2 flask without FCS. At the indicated time points, 2 mL of culture supernatant was concentrated (Amicon Ultra centrifugal filters, 2 minutes, 14,000 rpm) and 16 μL was used for Western blot. Lysates or supernatants were resolved in a 4% to 12% NuPAGE Bis-Tris gel under reducing and denaturing conditions and blotted onto a nitrocellulose membrane (BA83, Sigma-Aldrich, Taufkirchen, Germany). Membranes were blocked in 5% dry milk and probed using the following antibodies: anti-C1r (sc-514105, Santa Cruz; 1:200), anti-C1s (sc-365273, Santa Cruz; 1:200), anti-C1q (ab75756, abcam, Cambridge, United Kingdom; 1:1000), and anti–β-actin (A5316, Sigma-Aldrich; 1:5000). Immunoreactive signals were detected by chemiluminescence (Lumi-Light PLUS, Roche). HEK293XL-hTLR7-HA and HEK293XL-hTLR9-HA cells (Invivogen, San Diego, Calif) were seeded in a 96-well plate at a density of 8 × 103 cells/well in Dulbecco modified Eagle medium supplemented with 10% FCS, 2 mM l-glutamine, 1% antibiotics-antimycotics, HEPES, and blasticidin. After 48 hours, cells were transfected with 0.3 μL lipofectamine 3000 and 100 ng FCγRIIA-GFP plasmid.E5Means T.K. Latz E. Hayashi F. Murali M.R. Golenbock D.T. Luster A.D. Human lupus autoantibody-DNA complexes activate DCs through cooperation of CD32 and TLR9.J Clin Invest. 2005; 115: 407-417Crossref PubMed Scopus (668) Google Scholar R848 (10 μg/mL, Invivogen) and ODN2006 (5 μM, Invivogen) were used as positive control for stimulation of HEK293XL-hTLR7-HA and HEK293XL-hTLR9-HA, respectively. Immune complexes were isolated by polyethylene glycol precipitation as described previouslyE6Mathsson L. Lampa J. Mullazehi M. Rönnelid J. Immune complexes from rheumatoid arthritis synovial fluid induce FcgammaRIIa dependent and rheumatoid factor correlated production of tumour necrosis factor-alpha by peripheral blood mononuclear cells.Arthritis Res Ther. 2006; 8: R64Crossref PubMed Scopus (96) Google Scholar and concentrated with ultrafiltration columns (Advantec USY-20). Forty-eight hours after transfection, HEK cells were incubated for 22 hours with 30 μL immune complexes in a volume of 300 μL. PBMC blood from healthy donors was isolated by centrifugation using a Bicoll-Paque Plus density gradient. A total of 1.25 × 105 cells/48 wells were diluted in RPMI-1640 supplemented with 2 mM l-glutamine, 1% antibiotics-antimycotics, 1% HEPES, and 1% Ultroser G (Flow Laboratories, Meckenheim, Germany) and incubated with 50 μL immune complexes for 22 hours. For data normalization, cell viability was assessed by resazurin assay (Sigma-Aldrich). IFN-β and IL-8 were measured in supernatants using the LEGENDplex Human Anti-Virus Response Panel (Biolegend, San Diego, Calif) according to the manufacturer’s instructions. Data were collected on a FACS flow cytometer (LSRII, Becton Dickinson, Heidelberg, Germany) and analyzed with the Legendplex Data Analysis V7.1 software (Biolegend). Heparin blood was distributed in 24-well plates at 1 mL per well. Plates were incubated on a shaker incubator at 300 rpm and 37°C. For IFN activation, cells were incubated with 1 μg/mL poly(I:C) (HMW, Invivogen) for 5 hours. were with 100 baricitinib or for an hours. was extracted from PBMCs or from lysed whole blood assay using the Mini Kit followed by I expression was determined by RT-PCR using PCR (Applied on an and to and 1 For a was in genes were analyzed using for and used for RT-PCR of were and The IFN was as Wu H. P. et of increased expression with disease activity and lupus nephritis in patients with systemic lupus 2006; PubMed Scopus Google Scholar Cutaneous Lupus Erythematosus Disease Area and Severity Index was assessed as J. L. S. G. S. et al.The Lupus Erythematosus Disease Area and Severity an for cutaneous lupus Dermatol. 2005; Full Text Full Text PDF PubMed Scopus Google Scholar was determined by of than were Data are as and was by all members of the family or their Patients were in an on the of chilblain lupus by the of the findings in of lupus in a Fig of homozygous C1R and C1QC mutations. A and of family A from and family B from with homozygous C1R and C1QC respectively. C and of C1r and C1qC with E and of the classical complement pathway in patients and their healthy of complement activity in patients can be fully restored by substitution with recombinant C1 Western and secretion of C1r and C1s in culture supernatant of patient Western C1qC protein in patient B1. was as