SARS‐CoV‐2 spike protein is present in both endothelial and eccrine cells of a chilblain‐like skin lesion
Thilo Gambichler, Judith Reuther, Markus Stücker, René Stranzenbach, C. Torres‐Reyes, Renate Schlottmann, Wolfgang E. Schmidt, Rami Hayajneh, Ashwin Sriram, Jürgen C. Becker
Abstract
2] An 80-year-old woman presented to the emergency department at the end of March 2020. She reported an onset of fever (38.4C) several days before admission, along with cough and shortness of breath. RT-PCR from a nasopharyngeal swab was positive for SARS-CoV-2. An X-ray showed evidence for right-sided pneumonic infiltrates. A blood collection revealed increased leucocyte count, C-reactive Figure 2 Detection of SARS-CoV-2 using the 2019-nCOV CDC EUA authorized qPCR probe assay primer/probe mix (Cat No: 10006770; IDT, Iowa, USA) according to the manufacturer's instructions (left side). Right part of the figure showing mRNA expression levels of KLK1 (kallikrein), stromal cell-derived factor 1 (SDF1) and GAPDH was measured by SYBR green assay using specific primers (KLK1, AGGCGGCTCTGTACCATTTC, GCACACCATCACACATCAGC; CXCL12, AAGGTCGTGGTCGTGCTG, TAGCTTCGGGTCAATG-CACA; and GAPDH, ACCACAGTCCATGCCATCAC, TCCACCACCCTGTTGCTGTA).